ID: 1054175462

View in Genome Browser
Species Human (GRCh38)
Location 9:61871892-61871914
Sequence CTGGCTACACATTAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054175462_1054175466 -1 Left 1054175462 9:61871892-61871914 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1054175466 9:61871914-61871936 GAGGTTGAGATGCAGGCCCTAGG No data
1054175462_1054175470 20 Left 1054175462 9:61871892-61871914 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1054175470 9:61871935-61871957 GGAAATGATACAAGAGATAAGGG No data
1054175462_1054175469 19 Left 1054175462 9:61871892-61871914 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1054175469 9:61871934-61871956 AGGAAATGATACAAGAGATAAGG No data
1054175462_1054175472 25 Left 1054175462 9:61871892-61871914 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1054175472 9:61871940-61871962 TGATACAAGAGATAAGGGGAAGG No data
1054175462_1054175464 -8 Left 1054175462 9:61871892-61871914 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1054175464 9:61871907-61871929 GTAGCCAGAGGTTGAGATGCAGG No data
1054175462_1054175471 21 Left 1054175462 9:61871892-61871914 CCAGGTTGCTAATGTGTAGCCAG No data
Right 1054175471 9:61871936-61871958 GAAATGATACAAGAGATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054175462 Original CRISPR CTGGCTACACATTAGCAACC TGG (reversed) Intergenic
No off target data available for this crispr