ID: 1054176961

View in Genome Browser
Species Human (GRCh38)
Location 9:61881789-61881811
Sequence GAACCCAAGTTGGGACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054176949_1054176961 29 Left 1054176949 9:61881737-61881759 CCAGAGAAAGCCCAGGTGAAAGA No data
Right 1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG No data
1054176957_1054176961 -1 Left 1054176957 9:61881767-61881789 CCTGTCGGAAGGGATCAGGGTAG No data
Right 1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG No data
1054176948_1054176961 30 Left 1054176948 9:61881736-61881758 CCCAGAGAAAGCCCAGGTGAAAG No data
Right 1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG No data
1054176950_1054176961 19 Left 1054176950 9:61881747-61881769 CCCAGGTGAAAGACTATGAGCCT No data
Right 1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG No data
1054176951_1054176961 18 Left 1054176951 9:61881748-61881770 CCAGGTGAAAGACTATGAGCCTG No data
Right 1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054176961 Original CRISPR GAACCCAAGTTGGGACAGGC AGG Intergenic
No off target data available for this crispr