ID: 1054177074

View in Genome Browser
Species Human (GRCh38)
Location 9:61882659-61882681
Sequence GACCCAGGCATTATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054177069_1054177074 10 Left 1054177069 9:61882626-61882648 CCTCAGCAGAGGGACCTGGATCT No data
Right 1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG No data
1054177063_1054177074 23 Left 1054177063 9:61882613-61882635 CCTCCAAACTGTCCCTCAGCAGA No data
Right 1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG No data
1054177065_1054177074 20 Left 1054177065 9:61882616-61882638 CCAAACTGTCCCTCAGCAGAGGG No data
Right 1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG No data
1054177068_1054177074 11 Left 1054177068 9:61882625-61882647 CCCTCAGCAGAGGGACCTGGATC No data
Right 1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG No data
1054177070_1054177074 -4 Left 1054177070 9:61882640-61882662 CCTGGATCTTCCCTAACTTGACC No data
Right 1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054177074 Original CRISPR GACCCAGGCATTATTTCCCC AGG Intergenic
No off target data available for this crispr