ID: 1054180451

View in Genome Browser
Species Human (GRCh38)
Location 9:61905613-61905635
Sequence CTACCTTCAAGAAGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054180451_1054180458 7 Left 1054180451 9:61905613-61905635 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1054180458 9:61905643-61905665 AGTCAGGGCCCTGTGGTGACTGG No data
1054180451_1054180457 0 Left 1054180451 9:61905613-61905635 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1054180457 9:61905636-61905658 GAATGGGAGTCAGGGCCCTGTGG No data
1054180451_1054180455 -9 Left 1054180451 9:61905613-61905635 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1054180455 9:61905627-61905649 TGAAGGTAGGAATGGGAGTCAGG No data
1054180451_1054180456 -8 Left 1054180451 9:61905613-61905635 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1054180456 9:61905628-61905650 GAAGGTAGGAATGGGAGTCAGGG No data
1054180451_1054180459 14 Left 1054180451 9:61905613-61905635 CCTGCTGAGCTTCTTGAAGGTAG No data
Right 1054180459 9:61905650-61905672 GCCCTGTGGTGACTGGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054180451 Original CRISPR CTACCTTCAAGAAGCTCAGC AGG (reversed) Intergenic
No off target data available for this crispr