ID: 1054188774

View in Genome Browser
Species Human (GRCh38)
Location 9:61972224-61972246
Sequence AAACCCATGCTGCTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054188774_1054188776 -7 Left 1054188774 9:61972224-61972246 CCAGGCAGAAGCAGCATGGGTTT No data
Right 1054188776 9:61972240-61972262 TGGGTTTCCACTCACACGGTAGG No data
1054188774_1054188777 -4 Left 1054188774 9:61972224-61972246 CCAGGCAGAAGCAGCATGGGTTT No data
Right 1054188777 9:61972243-61972265 GTTTCCACTCACACGGTAGGCGG No data
1054188774_1054188779 14 Left 1054188774 9:61972224-61972246 CCAGGCAGAAGCAGCATGGGTTT No data
Right 1054188779 9:61972261-61972283 GGCGGCTGTGCAATTTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054188774 Original CRISPR AAACCCATGCTGCTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr