ID: 1054189327

View in Genome Browser
Species Human (GRCh38)
Location 9:61976224-61976246
Sequence TCAAGTGGCCGCCTTCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054189323_1054189327 9 Left 1054189323 9:61976192-61976214 CCGGGTGTGACAGAGGCTCCTAG No data
Right 1054189327 9:61976224-61976246 TCAAGTGGCCGCCTTCACAGAGG No data
1054189321_1054189327 20 Left 1054189321 9:61976181-61976203 CCTGTGCACTGCCGGGTGTGACA No data
Right 1054189327 9:61976224-61976246 TCAAGTGGCCGCCTTCACAGAGG No data
1054189325_1054189327 -9 Left 1054189325 9:61976210-61976232 CCTAGAATCCTGTCTCAAGTGGC No data
Right 1054189327 9:61976224-61976246 TCAAGTGGCCGCCTTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054189327 Original CRISPR TCAAGTGGCCGCCTTCACAG AGG Intergenic
No off target data available for this crispr