ID: 1054190999

View in Genome Browser
Species Human (GRCh38)
Location 9:61985636-61985658
Sequence CCTCACCAGAAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054190991_1054190999 -4 Left 1054190991 9:61985617-61985639 CCTACCTAGGTACTTCTGGCCTC No data
Right 1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG No data
1054190992_1054190999 -8 Left 1054190992 9:61985621-61985643 CCTAGGTACTTCTGGCCTCACCA No data
Right 1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054190999 Original CRISPR CCTCACCAGAAGAAGGGGGA GGG Intergenic
No off target data available for this crispr