ID: 1054195453

View in Genome Browser
Species Human (GRCh38)
Location 9:62027601-62027623
Sequence GAGTGGAAGCAGCATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054195453_1054195460 -4 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195460 9:62027620-62027642 ACTCATGGCAGAAAGTGGATGGG No data
1054195453_1054195461 -3 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195461 9:62027621-62027643 CTCATGGCAGAAAGTGGATGGGG No data
1054195453_1054195462 2 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195462 9:62027626-62027648 GGCAGAAAGTGGATGGGGTGTGG No data
1054195453_1054195459 -5 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195459 9:62027619-62027641 CACTCATGGCAGAAAGTGGATGG No data
1054195453_1054195457 -9 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195457 9:62027615-62027637 CTTCCACTCATGGCAGAAAGTGG 0: 7
1: 19
2: 55
3: 179
4: 499
1054195453_1054195463 3 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195463 9:62027627-62027649 GCAGAAAGTGGATGGGGTGTGGG No data
1054195453_1054195464 25 Left 1054195453 9:62027601-62027623 CCTCCCTCATGCTGCTTCCACTC No data
Right 1054195464 9:62027649-62027671 GCGTGTGCAAAGAGATCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054195453 Original CRISPR GAGTGGAAGCAGCATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr