ID: 1054196593

View in Genome Browser
Species Human (GRCh38)
Location 9:62038005-62038027
Sequence CTTTGTAAGGTGAGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054196593_1054196599 12 Left 1054196593 9:62038005-62038027 CCTTTCTGCCTCACCTTACAAAG No data
Right 1054196599 9:62038040-62038062 GTTTGGGATTAATGTTGAGATGG No data
1054196593_1054196598 -4 Left 1054196593 9:62038005-62038027 CCTTTCTGCCTCACCTTACAAAG No data
Right 1054196598 9:62038024-62038046 AAAGGTACTTTACAAAGTTTGGG No data
1054196593_1054196597 -5 Left 1054196593 9:62038005-62038027 CCTTTCTGCCTCACCTTACAAAG No data
Right 1054196597 9:62038023-62038045 CAAAGGTACTTTACAAAGTTTGG No data
1054196593_1054196600 13 Left 1054196593 9:62038005-62038027 CCTTTCTGCCTCACCTTACAAAG No data
Right 1054196600 9:62038041-62038063 TTTGGGATTAATGTTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054196593 Original CRISPR CTTTGTAAGGTGAGGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr