ID: 1054196597

View in Genome Browser
Species Human (GRCh38)
Location 9:62038023-62038045
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054196591_1054196597 18 Left 1054196591 9:62037982-62038004 CCTGGGCTAACTGATGAAATCGG No data
Right 1054196597 9:62038023-62038045 CAAAGGTACTTTACAAAGTTTGG No data
1054196593_1054196597 -5 Left 1054196593 9:62038005-62038027 CCTTTCTGCCTCACCTTACAAAG No data
Right 1054196597 9:62038023-62038045 CAAAGGTACTTTACAAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054196597 Original CRISPR CAAAGGTACTTTACAAAGTT TGG Intergenic
No off target data available for this crispr