ID: 1054196600

View in Genome Browser
Species Human (GRCh38)
Location 9:62038041-62038063
Sequence TTTGGGATTAATGTTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054196596_1054196600 0 Left 1054196596 9:62038018-62038040 CCTTACAAAGGTACTTTACAAAG No data
Right 1054196600 9:62038041-62038063 TTTGGGATTAATGTTGAGATGGG No data
1054196593_1054196600 13 Left 1054196593 9:62038005-62038027 CCTTTCTGCCTCACCTTACAAAG No data
Right 1054196600 9:62038041-62038063 TTTGGGATTAATGTTGAGATGGG No data
1054196595_1054196600 5 Left 1054196595 9:62038013-62038035 CCTCACCTTACAAAGGTACTTTA No data
Right 1054196600 9:62038041-62038063 TTTGGGATTAATGTTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054196600 Original CRISPR TTTGGGATTAATGTTGAGAT GGG Intergenic
No off target data available for this crispr