ID: 1054198114

View in Genome Browser
Species Human (GRCh38)
Location 9:62054547-62054569
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054198112_1054198114 29 Left 1054198112 9:62054495-62054517 CCTACTTTTCATTTCTGAAAAAA No data
Right 1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054198114 Original CRISPR CTTTAAAAACAGAAGAATCT GGG Intergenic
No off target data available for this crispr