ID: 1054200106

View in Genome Browser
Species Human (GRCh38)
Location 9:62072371-62072393
Sequence CAGTGCTAAAACAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054200106_1054200111 -4 Left 1054200106 9:62072371-62072393 CCCTCTTCCCTGTTTTAGCACTG No data
Right 1054200111 9:62072390-62072412 ACTGGTTGATACTGAGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054200106 Original CRISPR CAGTGCTAAAACAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr