ID: 1054201018

View in Genome Browser
Species Human (GRCh38)
Location 9:62081511-62081533
Sequence ATGAAGAAGCCAACTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054201013_1054201018 14 Left 1054201013 9:62081474-62081496 CCAACGGTTTCCATGAAAGGAGG No data
Right 1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG No data
1054201016_1054201018 4 Left 1054201016 9:62081484-62081506 CCATGAAAGGAGGATGTGGTCAC No data
Right 1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054201018 Original CRISPR ATGAAGAAGCCAACTGAGGA AGG Intergenic
No off target data available for this crispr