ID: 1054202248

View in Genome Browser
Species Human (GRCh38)
Location 9:62095704-62095726
Sequence CTGAGTATTATCTACAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054202244_1054202248 25 Left 1054202244 9:62095656-62095678 CCACTTAGTTAGATGCAGGATGT No data
Right 1054202248 9:62095704-62095726 CTGAGTATTATCTACAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054202248 Original CRISPR CTGAGTATTATCTACAAGTT AGG Intergenic
No off target data available for this crispr