ID: 1054203068

View in Genome Browser
Species Human (GRCh38)
Location 9:62103810-62103832
Sequence AGGGGCAGGGTGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203068_1054203079 13 Left 1054203068 9:62103810-62103832 CCCTCCACCAGCACCCTGCCCCT No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203068_1054203078 7 Left 1054203068 9:62103810-62103832 CCCTCCACCAGCACCCTGCCCCT No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203068 Original CRISPR AGGGGCAGGGTGCTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr