ID: 1054203070

View in Genome Browser
Species Human (GRCh38)
Location 9:62103814-62103836
Sequence GCACAGGGGCAGGGTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203070_1054203078 3 Left 1054203070 9:62103814-62103836 CCACCAGCACCCTGCCCCTGTGC No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203070_1054203079 9 Left 1054203070 9:62103814-62103836 CCACCAGCACCCTGCCCCTGTGC No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203070 Original CRISPR GCACAGGGGCAGGGTGCTGG TGG (reversed) Intergenic