ID: 1054203071

View in Genome Browser
Species Human (GRCh38)
Location 9:62103817-62103839
Sequence TTGGCACAGGGGCAGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 4, 1: 5, 2: 27, 3: 88, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203071_1054203078 0 Left 1054203071 9:62103817-62103839 CCAGCACCCTGCCCCTGTGCCAA 0: 4
1: 5
2: 27
3: 88
4: 451
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203071_1054203079 6 Left 1054203071 9:62103817-62103839 CCAGCACCCTGCCCCTGTGCCAA 0: 4
1: 5
2: 27
3: 88
4: 451
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203071 Original CRISPR TTGGCACAGGGGCAGGGTGC TGG (reversed) Intergenic
900402219 1:2477258-2477280 AGGACACAGGGGCAGGGGGCGGG - Intronic
900617164 1:3570701-3570723 CTGGCACAGGGGCAGGGCAGGGG - Intronic
901199177 1:7457065-7457087 TTGGCGCAGGGGGCGGGTGAGGG - Intronic
901422751 1:9162122-9162144 CTGGCACAGCCGCAGGGAGCGGG + Intergenic
901733729 1:11298905-11298927 TTGGCACAGAGGCTGGGTGCAGG + Intergenic
901793835 1:11668945-11668967 GTGGCATGGGGGCAGGGTGGAGG + Intronic
902287367 1:15415348-15415370 GGGGCACAGAGGCAGGGGGCTGG - Intronic
902564584 1:17302886-17302908 GTGGCAGAGGGGAAGGTTGCAGG + Intergenic
902790628 1:18765442-18765464 CTGGGAAAGGGGTAGGGTGCAGG + Intergenic
903179106 1:21596615-21596637 TGGGCTGAGGGGCAGGGAGCCGG - Intronic
903275895 1:22221580-22221602 CTGGGACAGGTGCAAGGTGCTGG - Intergenic
903353085 1:22730051-22730073 TTGGCACAGGGCCAGGCCCCAGG + Intronic
903815057 1:26058914-26058936 GGGGGACAGGGGGAGGGTGCAGG - Intronic
904012098 1:27395718-27395740 TTGGCAGAGGGGTGGGGTGTTGG - Exonic
904900831 1:33855758-33855780 TTGGCCCAGAAACAGGGTGCAGG + Intronic
904913553 1:33953419-33953441 TTGGCACAGGTTGAGGCTGCAGG - Intronic
904993175 1:34610303-34610325 TTGGCCTAGGGGCAGAGTTCAGG + Intergenic
905091351 1:35433615-35433637 GTGGAACAGGGCCAGGGTGAGGG + Exonic
905323089 1:37131560-37131582 GAGGCACAGGGGTAGGGAGCAGG - Intergenic
906316076 1:44787069-44787091 CAGGCACAGGAGCTGGGTGCTGG - Intronic
906713678 1:47951536-47951558 TTTGCAGAGGGGCAGGCTCCAGG + Intronic
907519133 1:55011858-55011880 CTGGGAGAGGGGCAAGGTGCTGG + Intergenic
908817659 1:68050666-68050688 TGCGCACAGGAGCGGGGTGCGGG + Exonic
908935730 1:69373759-69373781 TCAGCACAGGGGCAGGATGCTGG + Intergenic
909024685 1:70468455-70468477 TTAGCACAGGGGCGGGGTGCTGG - Intergenic
909678371 1:78263555-78263577 TTAGCACAGGGGTGGGGTGCTGG - Intergenic
910333726 1:86105118-86105140 TTGACACAGGGGTGGGGTGCTGG + Intronic
912887342 1:113488884-113488906 TTGGCTCAGGGGTGGGGTACTGG - Intronic
915007886 1:152656702-152656724 TTGGCACAGTGGCTTGGGGCTGG + Intergenic
915053571 1:153103504-153103526 TTGGTATATGGGTAGGGTGCTGG - Intronic
915312997 1:155013737-155013759 TTGGCAGTGGGGGAGGGGGCGGG + Intronic
915445443 1:155972063-155972085 ATGCCACAGGGGGAGGGTGGAGG - Intronic
915459154 1:156059482-156059504 ATGGCACTGGGGAAGGGGGCTGG - Intergenic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
916861478 1:168810574-168810596 TGTGCTCAGTGGCAGGGTGCCGG + Intergenic
917567751 1:176230144-176230166 TTAGCTCAGGTGCAAGGTGCTGG - Intergenic
917895720 1:179484923-179484945 TTGGCACAGTGGCGGGGCACTGG - Intronic
918927766 1:190809817-190809839 TTGGCACAAAGACTGGGTGCTGG - Intergenic
919016711 1:192047664-192047686 TGGGCCCAGGGACAGGGTGTGGG + Intergenic
919207639 1:194437610-194437632 TTAGCACAAGGGCAGTGTGCTGG - Intergenic
919770538 1:201155384-201155406 TTAGCATAGGGGCTGGGTCCAGG + Intronic
919814662 1:201429875-201429897 TGGGCACATGGGCCTGGTGCTGG - Intergenic
919849765 1:201664810-201664832 GTGGCAGAGGGGCAGGCTGAGGG - Intronic
920232661 1:204480865-204480887 ATGGCACAGGGACAGTGGGCTGG - Intronic
921404535 1:214764767-214764789 TTGGCACAGGGGCGGGGCTCTGG + Intergenic
921404560 1:214764897-214764919 TTGGTGCAAGGGTAGGGTGCTGG + Intergenic
922550036 1:226488117-226488139 TTGGCAAAGGGGCACAGGGCAGG - Intergenic
923265258 1:232307539-232307561 TTGGAAGAGGGGAAGGGTGCCGG - Intergenic
923855340 1:237839398-237839420 TTGGCTCAGGGGGAGGGCGCTGG - Intergenic
924331728 1:242946505-242946527 TTTGCAGAAGTGCAGGGTGCTGG - Intergenic
1063216710 10:3932052-3932074 GGGGCACAGGGACGGGGTGCAGG + Intergenic
1063385555 10:5614189-5614211 GTGGAACAGGGGCAGGGAGGAGG - Intergenic
1063603345 10:7501373-7501395 TTGGGACAGTGCCACGGTGCTGG - Intergenic
1063819722 10:9820145-9820167 TTAGCATGGGGGCAGGTTGCTGG - Intergenic
1064305718 10:14164312-14164334 TAGGCACAGGGACAGGGACCAGG - Intronic
1067838517 10:49656849-49656871 GTAGGACAGGGGCAGGGTGAAGG + Intronic
1068134192 10:52935557-52935579 TGGGCACAGGGGTAAGGTGGAGG - Intergenic
1068653721 10:59553330-59553352 CTGGCACAGGAGCTGGGAGCAGG + Intergenic
1068833113 10:61520610-61520632 TCTGTACAGAGGCAGGGTGCTGG + Intergenic
1069072005 10:63998737-63998759 TTAGTGCAAGGGCAGGGTGCTGG - Intergenic
1069240301 10:66130035-66130057 TTGGCACAGGGGCAGGATGCTGG - Intronic
1069782277 10:70964484-70964506 TAGGCACAGGGCTAGAGTGCAGG - Intergenic
1069919410 10:71807479-71807501 ATGGCACAGGGTGAGGGGGCAGG - Intronic
1070226675 10:74515549-74515571 GTGGCACGGGGGCAGTCTGCGGG + Intronic
1070595330 10:77829110-77829132 GTGGGACTGGGGCAGGGTGCAGG - Intronic
1070664833 10:78335741-78335763 TTTGCTCAGCTGCAGGGTGCAGG + Intergenic
1071358053 10:84818119-84818141 TTGGCGCAGGGGCACGGTGCTGG + Intergenic
1071736250 10:88303830-88303852 TTGGCCTGGGGGCAGGGTGCTGG - Intronic
1071979391 10:90988181-90988203 TTGGGCGGGGGGCAGGGTGCAGG + Intergenic
1073134643 10:101213779-101213801 TTGGCACTGCGGCGGGCTGCGGG - Intergenic
1073357555 10:102869465-102869487 TCGGCACAGGAGCTGGCTGCGGG + Intronic
1073403842 10:103279468-103279490 ATGGCACAGAGGCAGGGGACAGG + Intronic
1073558944 10:104480971-104480993 TTGTCACAGGGTCAGGCTGTGGG + Intergenic
1073863227 10:107770944-107770966 TTGGCATGGGTACAGGGTGCTGG - Intergenic
1074247686 10:111711582-111711604 TTGGCTCAGGGGCAGAATGCAGG - Intergenic
1074696122 10:116051502-116051524 ATGCCACAGGGGAAGGGGGCTGG + Intergenic
1075372575 10:121950385-121950407 TTGGGACAGAGGCAAGGTGGTGG + Intergenic
1076160549 10:128241117-128241139 TGGCCACAGGGGCAGGATGGCGG - Intergenic
1076555128 10:131316502-131316524 CTGGCAGAGGGACAGGGCGCTGG - Intergenic
1077341612 11:2028783-2028805 ATGGCGCAGGGGCACGGGGCAGG - Intergenic
1077375468 11:2203503-2203525 GAGGCACAGGGGCAGGGACCAGG - Intergenic
1078402279 11:11038725-11038747 TAGGCACAAGCGCAGGTTGCTGG - Intergenic
1078413968 11:11150116-11150138 TTGCAGCAGGGGCAGGGTGTGGG + Intergenic
1079106112 11:17573427-17573449 TTGGCAGAGATGGAGGGTGCAGG - Intronic
1079427740 11:20359639-20359661 TTGGCAGAGGGACTGGGTCCTGG + Intergenic
1080281383 11:30561548-30561570 TTGGCACAGTGGCTGGTGGCTGG - Intronic
1080424146 11:32140551-32140573 TTTCCCCAGGGGCAGGGAGCTGG + Intergenic
1081487785 11:43545391-43545413 TTGTCACAGGGAGAGGATGCTGG - Intergenic
1083636189 11:64122301-64122323 CTGACACAGGGCCAGGATGCAGG + Intronic
1083811355 11:65108537-65108559 CTGGCGCAGGAGCAGGGTGGTGG + Exonic
1083896591 11:65623114-65623136 TAGGCACAGGGACTGGGTGCTGG + Intronic
1083898744 11:65633540-65633562 ATGTCACATGGGCAGGGGGCGGG - Intronic
1084287578 11:68142017-68142039 TTGGCACAGGGGCTTGGCACCGG - Intergenic
1084539453 11:69776789-69776811 TTGGCCAGGGTGCAGGGTGCAGG + Intergenic
1084750869 11:71203854-71203876 GAGGCTCAGGAGCAGGGTGCAGG + Intronic
1084994983 11:72967799-72967821 TGGGCAGAGAGGCTGGGTGCGGG + Intronic
1085047970 11:73364257-73364279 AGGGGACAGGGGCAGGGTGTGGG - Intronic
1085059024 11:73427534-73427556 GCAGCACAGTGGCAGGGTGCTGG + Intronic
1085170931 11:74449316-74449338 ATGGCACGGGGGCTTGGTGCTGG + Intergenic
1085522222 11:77145558-77145580 CTGGGACAGAGGCAGGGAGCGGG + Intronic
1086061181 11:82701455-82701477 GTTGCACAGGGGCTGGGTCCGGG - Intergenic
1087377984 11:97368030-97368052 TTAGCACAGTGGTGGGGTGCTGG - Intergenic
1088031326 11:105254306-105254328 TTGGCAGGGGGGCGGGGTGGAGG + Intergenic
1088505381 11:110522221-110522243 GAAGCACAGGGGCAGGGGGCAGG - Intergenic
1090352916 11:126118967-126118989 AGGGCACAGGGGCAGGGGACTGG + Intergenic
1090684530 11:129100662-129100684 TTAGTATAAGGGCAGGGTGCAGG - Intronic
1090805612 11:130200209-130200231 TTGGCACCGAGGCAGGGCACTGG + Intronic
1202824598 11_KI270721v1_random:83972-83994 ATGGCGCAGGGGCACGGGGCAGG - Intergenic
1092242103 12:6841401-6841423 GTGGCCCAGGGGGAGGGGGCTGG + Intronic
1092288751 12:7145900-7145922 GCGGCACAGAGGCAGGGTCCAGG - Intronic
1092333633 12:7608501-7608523 TTGGCATGGGGGAAGGGTGCTGG - Intergenic
1092761466 12:11814917-11814939 GTGGTACAGGGGCAGGGTCTGGG + Intronic
1092910373 12:13140429-13140451 ACGGCACAGGGGCTGGGTGTAGG - Intronic
1093490744 12:19701264-19701286 TTGTAGCAAGGGCAGGGTGCTGG - Intronic
1094323549 12:29211538-29211560 TTGGCTCAGGGTCAGAATGCAGG + Intronic
1094731354 12:33179867-33179889 TTTGCACAGGGGAAGGGGGAGGG - Intergenic
1094734779 12:33222594-33222616 TTGGCTCAGGGGTAGGGTGCTGG + Intergenic
1095334136 12:41006450-41006472 TTAGCTCAGGGGCTGGGTACTGG + Intronic
1096228309 12:49883245-49883267 AGGGCACAGGGGCAGCCTGCAGG + Intronic
1096542748 12:52317415-52317437 CTGGCTCAGGGGAAGGATGCAGG + Intronic
1096955018 12:55517244-55517266 TTGGCACAGGGGCAATGTGCTGG - Intergenic
1097189907 12:57214675-57214697 ATGGCAGAGGGGCAGGGTTGGGG - Intergenic
1098602021 12:72343253-72343275 TATGCACAGGGGCGGGGTGGGGG - Intronic
1099115531 12:78619694-78619716 AGGGCACAGGTACAGGGTGCTGG - Intergenic
1099394549 12:82121433-82121455 TTGGTGCAGGGGCAGAATGCTGG - Intergenic
1099635484 12:85206259-85206281 TGGGCACATGGGTGGGGTGCTGG + Intronic
1099732754 12:86526205-86526227 TTGGTACAAGGGCAGGGTGCTGG + Intronic
1100406652 12:94277801-94277823 TTAGCACGGGGCCAGGCTGCTGG - Exonic
1101471199 12:104998906-104998928 TTGACACAGGGGCAGGGTACTGG + Intronic
1101639810 12:106579745-106579767 ATAGCACAGGGGCAGGGAGGGGG - Intronic
1102054154 12:109883598-109883620 CTGGCACTAGGACAGGGTGCGGG - Intergenic
1104410145 12:128550989-128551011 TTCCCACAGGGTCAGGCTGCAGG + Intronic
1104502213 12:129297171-129297193 TTGCCACAGTAGCAGGGGGCTGG + Intronic
1104983728 12:132585378-132585400 GTGGCACTGGGGGAGGGGGCTGG - Intergenic
1106520661 13:30494805-30494827 TTGGCACAGGGGTTGGGGGAGGG - Intronic
1107776663 13:43851444-43851466 TTGGCTCAGGAGCAGGGTGCTGG - Intronic
1108775654 13:53761942-53761964 TTAGCACAGGAGCAGGGCACTGG - Intergenic
1109667039 13:65553230-65553252 TTAGCACAAGGGGAGAGTGCTGG + Intergenic
1111113809 13:83750009-83750031 TTTGTACAAGGGCAGGGTTCTGG - Intergenic
1112155240 13:96809908-96809930 TTGGCACAGGGCCTGGGGCCTGG + Intronic
1113541083 13:111110247-111110269 GTGGCCCAGGGGAAGGCTGCAGG + Intergenic
1114417833 14:22556210-22556232 TTGACACAGACGCAGGGCGCTGG - Intergenic
1114647457 14:24263571-24263593 TTGGCCCAGGGGCCTGGTCCTGG + Intronic
1114933628 14:27506661-27506683 TTGGCACATGGGCAAGGTGCTGG + Intergenic
1115491861 14:33965609-33965631 TTGGAACAGGGGCATAGTGTGGG - Intronic
1116243590 14:42379334-42379356 TTGGCACAAGGGTGGGGTACTGG - Intergenic
1116431754 14:44854258-44854280 TTGGCTCATGGGTGGGGTGCTGG - Intergenic
1117224263 14:53638629-53638651 TTGGCCCAGGGTCATGTTGCAGG - Intergenic
1117285553 14:54282878-54282900 TTGGAACAGGTGCAGGGAGCTGG + Intergenic
1117638790 14:57775126-57775148 TTAGCACAGGGGTGGGGTGCTGG - Intronic
1117699610 14:58399736-58399758 TAGGCACAGTGGCAAGGTGGGGG - Intronic
1119703547 14:76770621-76770643 AGGGTGCAGGGGCAGGGTGCAGG - Intronic
1120401766 14:84041385-84041407 TGGGCACAGGGCCAGGGAGTGGG + Intergenic
1122307830 14:100776831-100776853 TTGGCACAGGGGCTGGGCATGGG - Intergenic
1122318240 14:100838054-100838076 TTTGCACAGGGGCAGGCTGCTGG + Intergenic
1122356983 14:101128882-101128904 TAGGATCCGGGGCAGGGTGCAGG + Intergenic
1122793357 14:104193654-104193676 ATGGCACTGGGGCTGGGTGGAGG - Intergenic
1122827697 14:104378851-104378873 TAGTCAGAGGGGGAGGGTGCGGG + Intergenic
1123932697 15:25179466-25179488 CTTGCAGAGGGGCAGGGTGTGGG + Intergenic
1124077792 15:26462188-26462210 TTGACACAAGGGTAGGATGCTGG - Intergenic
1124243814 15:28053431-28053453 CTGGCACAGGGGCTGGGAGAGGG - Intronic
1125600967 15:40915635-40915657 ATGCCCCAGGGGCAGGGGGCGGG - Intergenic
1125884016 15:43214993-43215015 CTGCCACAGGGGCCTGGTGCAGG + Intronic
1127004867 15:54557347-54557369 TTGGCAGATGGGCAGGGCACAGG - Intronic
1127302919 15:57675225-57675247 TAGGAACAGGGGCATTGTGCAGG + Intronic
1128303266 15:66580771-66580793 TGGCCACAGTGGCAGGGTGATGG - Intergenic
1128524426 15:68402842-68402864 AGGGCACAGGGGCAGGATGGAGG + Intronic
1130424038 15:83777114-83777136 TTGGCTCAGGGGCGGGGCACTGG - Intronic
1130540543 15:84817992-84818014 TGGGGACAGGGAGAGGGTGCTGG + Intronic
1130605467 15:85312646-85312668 TTGGTACGGGGGCTGGATGCCGG + Intergenic
1131039989 15:89255461-89255483 GTGGCAAAGGGACAGGGTGGGGG + Intronic
1131539201 15:93261911-93261933 GTGGCACAGTTGCGGGGTGCAGG + Intergenic
1132016234 15:98319940-98319962 TGGGCACACGGGCAGTGTTCAGG - Intergenic
1132649154 16:1012752-1012774 TGGGCAGAGGGGCAGGATGCAGG - Intergenic
1132763914 16:1524975-1524997 GTGGCACAGGGGCGGGGTGGGGG - Intronic
1132948810 16:2548612-2548634 GTGGCACCGGGGCGGGGTCCTGG - Intronic
1132965777 16:2653515-2653537 GTGGCACCGGGGCGGGGTCCTGG + Intergenic
1133031514 16:3013433-3013455 CTTCCACAGGGGCAGGGCGCAGG - Exonic
1133100072 16:3474093-3474115 TGGGCACAAGGGCGGGGTGGGGG + Intronic
1136120733 16:28131913-28131935 TTGCAACAGGTGCAGGGGGCAGG + Intronic
1136475484 16:30510540-30510562 TTGGCTCAGGAGAAGGGAGCAGG + Intronic
1137017493 16:35392550-35392572 GTGACACATGGGCAGGGGGCAGG - Intergenic
1138368083 16:56499819-56499841 TTGGCTCACTGGCAGGGTCCAGG + Exonic
1138551602 16:57751743-57751765 TGGGCCCAGGGGCTGGGGGCTGG + Intronic
1138883900 16:61050997-61051019 TTGGTTCAGGGGCTGGGTACTGG + Intergenic
1139596575 16:67961774-67961796 TTGGAACAGGGCCAGGGACCAGG - Intronic
1140457581 16:75114059-75114081 TGGCCTCAGGGGCAGGGTGCAGG + Exonic
1140731168 16:77858078-77858100 TGGGCACAGGAGCAGAGGGCCGG + Intronic
1141615536 16:85207533-85207555 CTGCCGCTGGGGCAGGGTGCAGG - Intergenic
1142067110 16:88068975-88068997 TGGGTGCAGGGGCAGGGGGCTGG - Intronic
1142717381 17:1754611-1754633 GTGGCACTGGGGCAGGGGCCGGG + Exonic
1142720913 17:1775206-1775228 TAGGGATAGGGGCAGGGTGGGGG + Intronic
1142748966 17:1976232-1976254 AAGGCCCAGGGGCAGGGGGCTGG + Intronic
1143375459 17:6464371-6464393 TTGGCAGAGGGGCTGGGCGGGGG + Intronic
1143456281 17:7070016-7070038 GTGGCACAGGGACAGGAAGCAGG - Intergenic
1143586534 17:7853414-7853436 AGGGCACTGGGGCAGGCTGCAGG + Exonic
1143609090 17:8007320-8007342 TTGGCTCAGGGGAGGGGTCCTGG - Intronic
1143973465 17:10812853-10812875 TTGGCACTGGGCCTGGCTGCGGG - Intergenic
1144836389 17:18158661-18158683 TTCCCACAGTGGGAGGGTGCTGG + Intronic
1145986403 17:29049891-29049913 ATGCCACAGGGGCAGAGAGCTGG + Intronic
1146232986 17:31130498-31130520 TTAGCACAGGGGCAGGGTGCTGG + Intronic
1146681301 17:34810343-34810365 TAGGAACAGGGGCTGAGTGCTGG - Intergenic
1148637867 17:49162946-49162968 GTGGCACAGGGGGAGGGTTCTGG + Intronic
1148724579 17:49779468-49779490 TGGACAAAGGGGCAGGGTGGAGG + Intronic
1148773482 17:50079960-50079982 GTGTCCCAGGGGCAGGGAGCTGG + Intronic
1149661512 17:58336527-58336549 TTCGCACTGGGGCAGGGTTCTGG + Intergenic
1150631716 17:66884854-66884876 TGGGGACAGGAGCAGGGTCCTGG - Intronic
1151589278 17:75032812-75032834 TTGGCCCTGGGGCAGAGTGCTGG + Intronic
1151756954 17:76080496-76080518 GTGGTGCAGGGGCAGGGTGCGGG + Intronic
1151890798 17:76949408-76949430 TGGACAGAGGGGCAGGGGGCTGG + Exonic
1152083843 17:78205401-78205423 TTGTCACAGGGCCAGGCTCCAGG - Intronic
1152361599 17:79835530-79835552 AGGGAACAGGGTCAGGGTGCTGG + Intronic
1152433627 17:80262395-80262417 TTGGGACAGGGGCTTGGGGCTGG + Intronic
1152745053 17:82034686-82034708 CAGGCAGAGGGGCAGGGTGGAGG + Intergenic
1153399460 18:4667148-4667170 TTAGCACAGGGATGGGGTGCTGG - Intergenic
1154464327 18:14629482-14629504 TGTGCACAGGGCCAGGGTTCTGG + Intergenic
1155519040 18:26651128-26651150 TTGGCATAACAGCAGGGTGCTGG + Intronic
1156450628 18:37264429-37264451 CTGGCCCAGGGGCAGGGGCCTGG - Intronic
1156467765 18:37358662-37358684 TTGGCACAGGAGCAGGATGCAGG + Intronic
1157007836 18:43607082-43607104 TTGGCACAGGAGCAGGACACTGG + Intergenic
1157227639 18:45881387-45881409 TTCCCACAGAGGCAGGTTGCAGG - Intronic
1157551068 18:48582237-48582259 TTGGCAAGGCGGCAGGGGGCAGG + Intronic
1158247844 18:55452135-55452157 TTGGAACAGAGGCAGGGGGAAGG - Intronic
1159122873 18:64190871-64190893 TCGTCACAGGGGCAGTGTGGAGG - Intergenic
1159177605 18:64858611-64858633 TTGGTACAGTGGCAAGGTGTTGG + Intergenic
1159505357 18:69328449-69328471 TGGGCGCAGGGGCAGGGTGCTGG - Intergenic
1159883153 18:73878659-73878681 TTGGGGCAGGGGCAGAGTGAGGG + Intergenic
1159906011 18:74092996-74093018 TTGGCACAGGGGCAGGGTGCTGG + Intronic
1160678090 19:401050-401072 TTGTCACAGTGCCGGGGTGCAGG + Intergenic
1160922144 19:1526036-1526058 TAGGCACAGGGGCATGCTGGTGG - Intronic
1161014739 19:1978089-1978111 TGACCACACGGGCAGGGTGCAGG + Intronic
1161166508 19:2790745-2790767 TGTGCTCAGGGGCAGGGTGCTGG - Intronic
1161189331 19:2944501-2944523 GGGGCACAGGGGCAGTTTGCGGG - Intronic
1161401359 19:4067274-4067296 TCTGCGCAGGGGCGGGGTGCGGG + Intergenic
1161424779 19:4197195-4197217 CTGGGGCAGGGGCGGGGTGCTGG + Intronic
1162824167 19:13241348-13241370 GAGGCACAGGGGCTGGGGGCGGG + Intronic
1163421558 19:17216204-17216226 TTGGCACACGGCCAGGGGCCAGG - Exonic
1163596919 19:18225835-18225857 CTGGCACTGGGACAGGATGCTGG + Intronic
1163659308 19:18567312-18567334 TGGGGGCAGGGTCAGGGTGCTGG + Intronic
1164250395 19:23470540-23470562 TTTCCACAGGGGAAGGATGCTGG - Intergenic
1164394389 19:27850779-27850801 TGGGCCCAGGGGCGGGGTGGGGG + Intergenic
1165902607 19:39175675-39175697 TGGGCCCAGGGGCAGGGATCTGG + Intronic
1166188903 19:41162138-41162160 GTGGATAAGGGGCAGGGTGCTGG + Intergenic
1166252038 19:41577931-41577953 TTGGGACAGGGGCCTGGGGCAGG - Intronic
1166741647 19:45118194-45118216 TGGGGACAGCGGCTGGGTGCCGG - Intronic
1166855555 19:45781252-45781274 GGGCCAGAGGGGCAGGGTGCTGG + Intronic
1167440649 19:49506840-49506862 TAGGCACAGAGGCAGGGGCCAGG + Intronic
1167667486 19:50831311-50831333 TTGGCACAGGTGGAGGGTGAAGG + Intronic
1168228843 19:55015776-55015798 TAGGCACAGTGACAGGGGGCGGG - Intronic
1168244748 19:55106611-55106633 TTTGCACAGGGGCATGGAACTGG - Intronic
925234555 2:2266575-2266597 ATGGCACAGGAGCAGGGAGTGGG + Intronic
925416409 2:3672991-3673013 CTGGCACAATGCCAGGGTGCTGG + Intronic
926197081 2:10770485-10770507 ATGGGACAGGGGCCGGGCGCCGG + Intronic
927191851 2:20522469-20522491 TGGGAACAGGGGCGGGGTGTAGG - Intergenic
927196997 2:20554965-20554987 ATGGCAGAAGGGCAGGATGCTGG - Intergenic
927415387 2:22874110-22874132 TTGGGACATGGGCAGGGGGAGGG - Intergenic
927715434 2:25348894-25348916 TTCACCCATGGGCAGGGTGCCGG - Intergenic
927826316 2:26312305-26312327 TCAGCAGAGGGGCTGGGTGCAGG - Intronic
930030684 2:47056472-47056494 TTAGCACAGGGCCAGCCTGCGGG + Intronic
930529550 2:52572537-52572559 ATGGCTGAGCGGCAGGGTGCCGG - Intergenic
931077541 2:58733425-58733447 TTGGCACTAGGACAGGGTGCTGG - Intergenic
931248776 2:60512427-60512449 GTGGCACAGGGGCAGGTAGAAGG - Intronic
931463544 2:62468083-62468105 TTGGCAAATGTGCAGGGGGCTGG + Intergenic
931489136 2:62725466-62725488 TTGGCACAGGGGTGGGGCACTGG + Intronic
931489155 2:62725592-62725614 TTGGTACAAAGGCAGGGTGCTGG + Intronic
932539729 2:72639361-72639383 TTGGATCAGGGGCAGGGTGCTGG - Intronic
933555212 2:83823251-83823273 GTGACACAGGGGCAGGGCACTGG + Intergenic
933895601 2:86807809-86807831 TGGGCGCAGGGGCAGGGAGCTGG + Intronic
934299533 2:91768919-91768941 CTGGGACAGGTGCAGGCTGCAGG - Intergenic
935344389 2:102092256-102092278 TTGGCAGAGGGGCGGGAGGCTGG + Intronic
935686783 2:105690743-105690765 TTGGCACAGGACCCTGGTGCTGG + Intergenic
935845824 2:107164684-107164706 TTGGGACAGGGGCAACATGCAGG - Intergenic
936324197 2:111490958-111490980 ATGGCACAGGGGGAAGTTGCAGG + Intergenic
937818234 2:126276690-126276712 TTGGGATGGGAGCAGGGTGCAGG + Intergenic
937856177 2:126673378-126673400 CTGGGACAGTGGCAGGGTGGGGG + Intronic
938687441 2:133753834-133753856 TTGGCACCTGGCCAGCGTGCTGG - Intergenic
940030701 2:149258584-149258606 TAGGCACAGATGCTGGGTGCTGG + Intergenic
941003276 2:160222772-160222794 AGGGCCCAGGGGCAGGTTGCTGG + Intronic
941757364 2:169201831-169201853 TTGGCACAGGTGAAGGCTGTCGG + Exonic
941761138 2:169244860-169244882 TTGTCACAGCGCCAGTGTGCAGG + Exonic
943092326 2:183389996-183390018 TTTGTACAGGAGCAGGGTGCTGG + Intergenic
943501286 2:188693006-188693028 CTTGCACAGAGGTAGGGTGCTGG + Intergenic
943670444 2:190654501-190654523 CTGGCACAGGGGCAGGGAAGTGG + Intronic
944448726 2:199819264-199819286 CTGGCACTGGGGCAGGGTCCTGG - Exonic
944539564 2:200742900-200742922 TTGGCAGAGGCACAGGGAGCAGG - Intergenic
944661284 2:201923837-201923859 CTGGCACAGGAGCAGGGGACTGG + Intergenic
944704888 2:202278899-202278921 TTGGCAGAGGGGTAGGCTGAAGG + Intronic
946163798 2:217851674-217851696 TAGGCACAGGGCCAGGTTGGTGG - Intronic
946171322 2:217897697-217897719 CTGGCACAGGGGCTGGTGGCAGG + Intronic
946172675 2:217904886-217904908 TTGGCAAGGGGACAGGGTGATGG - Intronic
946229534 2:218282818-218282840 GTGGTACAGGGGCTGGGGGCAGG + Intronic
946347130 2:219119581-219119603 CTGGGCCAGGGGCAGGGTGGCGG - Intronic
946419797 2:219558260-219558282 GTGGGGCAGGGTCAGGGTGCGGG + Exonic
946671687 2:222111574-222111596 TTGGCTTAGGAGCATGGTGCTGG - Intergenic
948138194 2:235652808-235652830 TTTGATCAGGGGCAGGGAGCAGG + Intronic
1168826085 20:815230-815252 TGGGGACAGGTGCAGGGTGGGGG + Intergenic
1169210793 20:3765309-3765331 TTGGCACAGGAGGAGGCTGGAGG - Intronic
1170422558 20:16207245-16207267 TGTGCACAAGGGCAGGTTGCAGG - Intergenic
1171126435 20:22605985-22606007 TTGGCACAGGGGTGTGGTGTTGG + Intergenic
1172168506 20:32914009-32914031 GTGCCACAGGGGCAGGGCCCAGG - Intronic
1172700409 20:36850139-36850161 CTGGCTCAGGGGCGGGGAGCTGG + Intronic
1172881571 20:38203217-38203239 CAGGCACAGGGGCAGGGTTGTGG - Intergenic
1172955770 20:38757283-38757305 ATGGCAAAGGGGCAGCCTGCAGG + Intronic
1173202403 20:40963546-40963568 GTGGGACAGGGGAGGGGTGCTGG - Intergenic
1173204572 20:40982667-40982689 TTTGCACAGGGGACAGGTGCTGG - Intergenic
1173248574 20:41352582-41352604 TGGGCACAGAGGCAGAGTGAGGG - Intronic
1173353508 20:42265931-42265953 TTGGCACAGTGACAGGATTCAGG - Intronic
1173564518 20:44029371-44029393 AGGGCAGAGGGGCATGGTGCAGG - Intronic
1173858235 20:46265030-46265052 CCGGCACACGGGCAGGGTGGGGG - Intronic
1173863582 20:46299943-46299965 TTGGCAGAGTGGGAGGGGGCTGG - Intronic
1174368578 20:50071281-50071303 TTGGCACAGCGGGAGCCTGCTGG - Intergenic
1175844102 20:62049641-62049663 GTGGATGAGGGGCAGGGTGCGGG - Intronic
1175935516 20:62512092-62512114 TTTGCACATGGGCAGGTGGCAGG + Intergenic
1175942410 20:62543582-62543604 TTGGGAGAGAGGCAGGGTGGGGG - Intergenic
1176125842 20:63474225-63474247 TGGGCACAGAGGCAGGGAGGCGG - Intergenic
1176269513 20:64228556-64228578 TTCTCACTGGGGCAGGGTGGGGG + Intronic
1176345796 21:5745770-5745792 TTGACAAAGGAGCAGGGTGCTGG + Intergenic
1176352610 21:5866354-5866376 TTGACAAAGGAGCAGGGTGCTGG + Intergenic
1176499031 21:7578685-7578707 TTGACAAAGGAGCAGGGTGCTGG - Intergenic
1176540117 21:8143840-8143862 TTGACAAAGGAGCAGGGTGCTGG + Intergenic
1176559068 21:8326885-8326907 TTGACAAAGGAGCAGGGTGCTGG + Intergenic
1176725639 21:10430231-10430253 TTGTCACAGAGGCAGGGAGGAGG - Intergenic
1176810211 21:13528907-13528929 TGTGCACAGGGCCAGGGTTCTGG - Intergenic
1178442475 21:32610163-32610185 TTGACACGGGGGCATGGTACTGG + Intronic
1178958683 21:37044701-37044723 TTGGCCCAGTGGCAGGGTACAGG - Intergenic
1179025077 21:37673241-37673263 TAGGCCCAGGGGCAGCCTGCTGG + Intronic
1180042441 21:45287435-45287457 ATGGTATAGGGGCAGGGGGCAGG - Intronic
1180175478 21:46085114-46085136 CTGTCACAGGGGCAGGGTCGGGG - Intergenic
1180175492 21:46085174-46085196 CGGTCACAGGGGCAGGGTCCTGG - Intergenic
1180175505 21:46085234-46085256 CGGTCACAGGGGCAGGGTCCTGG - Intergenic
1180175519 21:46085302-46085324 CGGTCACAGGGGCAGGGTCCGGG - Intergenic
1180175533 21:46085370-46085392 CTGTCACAGGGGCAGGGTCGGGG - Intergenic
1180175549 21:46085430-46085452 CGGTCACAGGGGCAGGGTCCTGG - Intergenic
1180175562 21:46085490-46085512 CAGTCACAGGGGCAGGGTCCTGG - Intergenic
1180175576 21:46085558-46085580 CAGTCACAGGGGCAGGGTCCGGG - Intergenic
1180175589 21:46085618-46085640 CAGTCACAGGGGCAGGGTCCTGG - Intergenic
1180175603 21:46085686-46085708 CAGTCACAGGGGCAGGGTCCGGG - Intergenic
1180175618 21:46085754-46085776 CTGTCACAGGGGGAGGGTCCTGG - Intergenic
1180175631 21:46085814-46085836 CAGTCACAGGGGCAGGGTCCTGG - Intergenic
1180971755 22:19819618-19819640 TTAGCACAAGGGCAGGTTTCTGG - Intronic
1181033539 22:20159324-20159346 CTGGCACAGGGTCCGGGAGCAGG - Intergenic
1181180987 22:21068181-21068203 ATGGAACAGGGGCAGGGTGACGG - Intergenic
1181437360 22:22918544-22918566 ATGGGACAGGGGAAGGATGCTGG + Intergenic
1181509768 22:23383920-23383942 CTGGCACAGGGTCCGGGAGCAGG + Intergenic
1181921065 22:26320826-26320848 TTGGGACAATGGGAGGGTGCGGG + Intronic
1182010870 22:26999667-26999689 TTGGGTCAGGGGCAGGATGTGGG - Intergenic
1182155025 22:28063523-28063545 TGGGCAGTGGGGCAGGGTGGGGG - Intronic
1182273012 22:29167567-29167589 ATGGCACTGGGGCCGGATGCCGG - Exonic
1182366259 22:29781397-29781419 TTGGCAGAGGGGCAGGGGAAAGG - Intergenic
1182686192 22:32122890-32122912 TTGGCTCAGGGGGCGGGGGCAGG + Intergenic
1182755277 22:32674066-32674088 GTGGCACAGGGGATGAGTGCTGG + Intronic
1183120654 22:35727712-35727734 TTGGCACATAGCCAGTGTGCCGG + Intronic
1183232239 22:36590229-36590251 CTGGCACAGAAGCAGGGTTCAGG + Intronic
1183547293 22:38461351-38461373 CAGGCACTGGGGCTGGGTGCTGG - Intergenic
1183662485 22:39229846-39229868 GTGGCACAGGTGAAGGGTACTGG + Intronic
1183737987 22:39654413-39654435 TGGGCAGCAGGGCAGGGTGCGGG + Intronic
1184384083 22:44164410-44164432 TTGGCACAGGAGCCGGGGGGGGG - Intronic
1184430210 22:44438052-44438074 TTGGCACACGGGCAGGCGGCGGG + Intergenic
1185143575 22:49117242-49117264 TTGGGGCAGGGGCAGGGGTCGGG + Intergenic
1185320092 22:50196631-50196653 CTGGCACAGACGCTGGGTGCTGG - Intronic
1203245062 22_KI270733v1_random:60199-60221 TTGACAAAGGAGCAGGGTGCTGG + Intergenic
950496669 3:13338043-13338065 TCGGCAGAGGAGCATGGTGCTGG - Intronic
950669865 3:14519588-14519610 TGGGGCCAGGGGCAGGGTGGGGG - Intronic
950723414 3:14900515-14900537 TTGGAATTGGGGCAGGGTCCAGG - Intronic
950923064 3:16715143-16715165 TTAGCACAAGGGCAGGGTACTGG + Intergenic
951258871 3:20482606-20482628 TTGGCACAGGGATGGGGTGTTGG - Intergenic
953174419 3:40536610-40536632 GTGGCAAAGGTGGAGGGTGCTGG - Exonic
953358916 3:42278156-42278178 GAGTCACAGGGGCAGGGAGCTGG - Intergenic
953407378 3:42666089-42666111 ATGGCACTGGGGCAGGGAGCTGG + Intergenic
954078052 3:48195635-48195657 TTAGCACAGGGGTGGGGTGAGGG - Intergenic
954442240 3:50528141-50528163 TTGGCATGGGGTCCGGGTGCAGG - Intergenic
954509184 3:51106715-51106737 TTAGCACGGGGGCAGGGTACTGG - Intronic
955093259 3:55772862-55772884 TGGGTACAGGGGCAGGGAGCAGG - Intronic
955937310 3:64113719-64113741 TTAGTATAAGGGCAGGGTGCTGG - Intronic
956730126 3:72188840-72188862 TTTGGGTAGGGGCAGGGTGCTGG - Intergenic
956748593 3:72329060-72329082 TTGGGACTGGTCCAGGGTGCTGG + Intergenic
957633041 3:82743260-82743282 TTGGCACAGCGGCAGGGCACTGG - Intergenic
958459086 3:94371268-94371290 TTGGCTCAGGGGCTGGGTGCTGG + Intergenic
958963783 3:100536153-100536175 TTGGTGCAGGGGCAGGGTGAGGG - Intronic
959335977 3:105065991-105066013 TTTGCAGAGGGGGAGGGTGCAGG + Intergenic
960258073 3:115532978-115533000 TTAACACAGGGGCAGGGCACTGG + Intergenic
961162970 3:124745201-124745223 TTTGAGCAGGGGCAGGGTGAGGG + Intergenic
961574019 3:127820376-127820398 CTGGCACAGGGGGAGGGTGGTGG - Intronic
961780842 3:129319255-129319277 TGGGCACACGGGCTGGGGGCCGG + Intergenic
961988075 3:131158474-131158496 TTGGTACAGGGGCAGGGTGCTGG - Intronic
962335556 3:134527271-134527293 TTGGCTTGGGGGCAGGGCGCTGG + Intronic
962464876 3:135648961-135648983 TTGGCACAAGGGCAGGGCACTGG + Intergenic
964142768 3:153422235-153422257 TTGGTATAAGGGCAGGGTGTGGG - Intergenic
964646984 3:158969022-158969044 ATGGCACAGGCCCAGAGTGCAGG + Intronic
964734362 3:159901137-159901159 TAGGCCAAGGGGCAGGGGGCTGG - Intergenic
965181890 3:165414886-165414908 TTAGCATGGGGGCAGGGTGCTGG - Intergenic
966489997 3:180516951-180516973 TTAGCATGGGGGCAGGGTGCTGG - Intergenic
968742912 4:2340364-2340386 CTGGCACAGGGGCTGAGTCCAGG + Intronic
968948002 4:3675667-3675689 GAGGCACAGAGGCAGAGTGCTGG - Intergenic
969273093 4:6116163-6116185 ATGGCACAGAGGCCGGCTGCTGG - Intronic
969291278 4:6241586-6241608 AGGGGACAGGGGCAGGGGGCTGG + Intergenic
969318061 4:6393974-6393996 TTGGGACAGGGTCAAGGTGAGGG + Intronic
971529143 4:27662432-27662454 TTGGAACATGTGCAGGGTCCAGG + Intergenic
972270060 4:37502389-37502411 TTAGCACGTGGGTAGGGTGCTGG + Intronic
972313241 4:37900614-37900636 GTGGGGCAGGGGCAGGGAGCTGG + Intronic
973027642 4:45293051-45293073 TTAGCACAGGGGCAGGATTCTGG + Intergenic
973673666 4:53241825-53241847 TTGGCACAGGGGTGGGGTGCTGG - Intronic
975139144 4:70902513-70902535 TTGGCCGCGGGGCAGGCTGCAGG - Exonic
975511063 4:75194110-75194132 CTGGCACAGTGGCAGGGCACTGG - Intergenic
975511083 4:75194241-75194263 TTAGCACAGGGGTGGGCTGCTGG - Intergenic
975899194 4:79129804-79129826 TTAGCATGGGGACAGGGTGCTGG + Intergenic
976948443 4:90799144-90799166 TTGGCTCAGGGGTGGGGTGCTGG + Intronic
976948461 4:90799255-90799277 TTAGCACAAGGGCAGGGTGCTGG + Intronic
977626359 4:99193302-99193324 TTGACACAAAGGCAGGGAGCTGG + Intergenic
978596221 4:110379866-110379888 TTAGCACAGGAGTGGGGTGCTGG - Intronic
978688971 4:111483850-111483872 TTAGCAAAAGGGCAGGATGCTGG - Intergenic
978738068 4:112106946-112106968 ATGACTCAGGGGCTGGGTGCTGG - Intergenic
981276155 4:142900507-142900529 TTAGCACAGGGGCAGGGCACTGG + Intergenic
981454052 4:144933347-144933369 TTAGCGCAAGGGCAGGGTGCTGG + Intergenic
982450300 4:155544625-155544647 TGAGAACAGGGGCAGGATGCTGG + Intergenic
983858537 4:172675502-172675524 TTGGCTCAGGGGCAGGGTACTGG + Intronic
985754989 5:1708576-1708598 TTGGGACAGCAGCAGGGGGCTGG - Intergenic
988336443 5:29914138-29914160 TTAGCTTAAGGGCAGGGTGCTGG - Intergenic
988609311 5:32710577-32710599 GTGGCCCAGGGGGAGGGGGCTGG + Intronic
988807797 5:34756478-34756500 TTAGCTCAGGGGCCGGGCGCAGG + Intronic
988865008 5:35324801-35324823 TTGGCACAGGGACAGGGTGCTGG - Intergenic
988870628 5:35385258-35385280 TTGGCTCAGTGGTGGGGTGCTGG - Intergenic
988967274 5:36432129-36432151 TTAGCATAGGGGTGGGGTGCTGG + Intergenic
989086790 5:37685109-37685131 TTGGCACTGGGATGGGGTGCTGG + Intronic
990003877 5:50923265-50923287 TGGCCGCCGGGGCAGGGTGCCGG + Intergenic
990049123 5:51473942-51473964 GTGGCAGAGGGGCATGGTGTTGG + Intergenic
992365094 5:76083125-76083147 GTGGGACTGGGGCAGGGGGCGGG - Intergenic
993178467 5:84518641-84518663 TTATAAGAGGGGCAGGGTGCTGG + Intergenic
995187996 5:109291098-109291120 TCAGCACAAGGGCAGGGTGCTGG - Intergenic
996451356 5:123629104-123629126 TTGTCACAGGGGTGGGGTGCTGG - Intergenic
996663198 5:126027772-126027794 TTGGCTCAGAGGTAGGGTGCTGG - Intergenic
998275908 5:140753350-140753372 TTAGCATGGGGGCAAGGTGCTGG + Intergenic
998275930 5:140753483-140753505 TTGGTGCTGGGGCAGGGTGCTGG + Intergenic
1000681695 5:164193322-164193344 TATGCACAGGGGCAGGGAGCGGG - Intergenic
1000788348 5:165573599-165573621 CTGGCACAGGGGAAGGGTCGTGG + Intergenic
1001837426 5:174843935-174843957 TTGGGACTGGGGCTGGGTGGGGG + Intergenic
1002100322 5:176854506-176854528 GGGGCACAGCGGCAGGGGGCAGG - Intronic
1003179720 6:3781177-3781199 TTGGCACCGGTGCAGGGCACAGG - Intergenic
1004090409 6:12494730-12494752 TTAGCACAAGGGCAGGGTGCTGG - Intergenic
1005807062 6:29483973-29483995 TTGGCAAAAGGTCAGGGTTCAGG + Intergenic
1006829040 6:36957920-36957942 GTGGGAAAGGGGCAGGGCGCTGG - Intronic
1007125771 6:39424316-39424338 ATGGCAGAAGTGCAGGGTGCTGG - Intronic
1007484904 6:42174279-42174301 TGGGCAGAGGGGCAGAGAGCAGG + Intronic
1007687236 6:43674112-43674134 TGGGCACACAGCCAGGGTGCTGG + Intronic
1007688151 6:43679698-43679720 GTGGCACAGGGGAAAGGGGCTGG + Intronic
1008859679 6:56133936-56133958 TTGCTGCAGGGGCAGGGTCCTGG + Intronic
1009621582 6:66084819-66084841 TTGGTGCAGGGGCAGGGCACTGG + Intergenic
1013393709 6:109713366-109713388 TTAGCACAGGGGCAGGGCACTGG + Intronic
1013737940 6:113249033-113249055 TTGGCACAGGGGTGGGGCACTGG - Intergenic
1014987671 6:128031916-128031938 CTGACACAGGGTGAGGGTGCAGG - Intronic
1016745146 6:147571475-147571497 TGGGCAGGGGGGCGGGGTGCGGG - Intronic
1017816120 6:158017848-158017870 CTGGCACAGGGTGGGGGTGCCGG - Intronic
1018872506 6:167794368-167794390 GTGGCACAGGGGCCCGGCGCAGG + Intronic
1019409118 7:898973-898995 TTGTCACAGCGGCGGGGAGCTGG + Intronic
1019595080 7:1854684-1854706 TGGGGACAGGGGCAGGATGCTGG - Intronic
1020382012 7:7557295-7557317 TTGGCACAAGGGCAGGGCACTGG - Intergenic
1021168647 7:17371318-17371340 CTGGCACAGGGCCAGAGTGAAGG + Intergenic
1021425653 7:20496321-20496343 TTGGCACAGGAGTGAGGTGCTGG - Intergenic
1022466622 7:30656535-30656557 TGGGCACAGGGGTGGGATGCTGG - Intronic
1024061993 7:45704866-45704888 ATGGAGCAGGGGCAGGGTGAGGG - Intronic
1024427202 7:49239940-49239962 TTGGCTTGGGGGCAGAGTGCTGG + Intergenic
1026524188 7:71140310-71140332 TAGGACCAGGGCCAGGGTGCTGG + Intronic
1026765490 7:73157053-73157075 TGTGCACAGGGCCTGGGTGCTGG + Intergenic
1027041964 7:74966747-74966769 TGTGCACAGGGCCTGGGTGCTGG + Intronic
1027081678 7:75235608-75235630 TGTGCACAGGGCCTGGGTGCTGG - Intergenic
1027505895 7:79016780-79016802 TTGGCATAGGGGTGGGGTGCAGG - Intronic
1027627462 7:80563792-80563814 TTAGCACAAAAGCAGGGTGCTGG + Intronic
1028639883 7:93030022-93030044 TTAGCAGGGGGGCAGGGTGCTGG - Intergenic
1029390264 7:100270189-100270211 TGTGCACAGGGCCTGGGTGCTGG - Intronic
1029443994 7:100602942-100602964 TTGGAACAGGGGCAGGGCTAAGG + Intronic
1029622315 7:101697898-101697920 TGGGTACAGGGGCAGGGGGAGGG + Intergenic
1031008534 7:116500050-116500072 GTGGGACCGGGGAAGGGTGCGGG - Intronic
1031330050 7:120453108-120453130 CTGGCAAAGTGGCATGGTGCAGG - Intronic
1031702730 7:124945160-124945182 TTGGCACAGTGGCAGGGCACTGG - Intergenic
1032482328 7:132256873-132256895 GGGGCACAGGGACAGGGTGGGGG + Intronic
1033494095 7:141876713-141876735 CTGGCAAAAGGGCAGGGTGCTGG + Intergenic
1034612233 7:152381341-152381363 TTGTCACGGGGGCAGGGAGGGGG + Intronic
1034934695 7:155191269-155191291 TTGCCACGGGGGCCGGGTCCGGG + Intergenic
1035053829 7:156020357-156020379 TTGGAGCAGGGGTAGGGGGCAGG + Intergenic
1035164109 7:156974133-156974155 TGGGGAGAGGGGGAGGGTGCTGG - Intergenic
1035187555 7:157138605-157138627 TTGGGTGCGGGGCAGGGTGCGGG - Intergenic
1035337207 7:158137629-158137651 TTGGCTGACAGGCAGGGTGCAGG - Intronic
1035570228 8:667703-667725 GTGGCACTGGTGCAGGGAGCCGG - Intronic
1035606556 8:933686-933708 TGGGCACAAGGGGAGGGTGAGGG + Intergenic
1037205397 8:16312090-16312112 TTGGCATAGGGGCAGGCTGAAGG - Intronic
1037373539 8:18205345-18205367 TTGGCTTGGGGGTAGGGTGCTGG + Intronic
1037479587 8:19292127-19292149 TTGGCACAGGCGGTGGGTGGGGG - Intergenic
1039289362 8:36077383-36077405 TTGGCTCAAGGTCATGGTGCTGG - Intergenic
1040404422 8:47086243-47086265 TTAGCTCAAGGGCAAGGTGCTGG + Intergenic
1040540360 8:48348047-48348069 TTGGCTCAGGGGTAAGGTGCTGG - Intergenic
1040668576 8:49659154-49659176 TTGGCACAGGGGCAAGGTGCTGG - Intergenic
1040977892 8:53214618-53214640 TTGGCACAAGGGCAGGATGCTGG + Intergenic
1041289195 8:56292847-56292869 TTGGTGCAGAGGCAAGGTGCAGG + Intergenic
1042512233 8:69624123-69624145 TGGCAACAGGGGCAGGATGCTGG + Exonic
1042976684 8:74478087-74478109 TTAGCACAGGCACAGGGTGCTGG + Intronic
1043698345 8:83251082-83251104 TTGGCACTGGGGTGGGGTGCTGG + Intergenic
1046895145 8:119463846-119463868 TTGGCACAAAGGCAGGCTGCTGG - Intergenic
1046895168 8:119463976-119463998 TTGGTACAGGGGCAGGGTCCTGG - Intergenic
1049088476 8:140495722-140495744 TTGGCAATGGGGCAGGGGGCTGG - Intergenic
1049463933 8:142742538-142742560 ATGGCAGACGGGCAGGGAGCTGG + Intergenic
1049660312 8:143816886-143816908 TAGGCAGAGGGGCAGGGTGGTGG - Intronic
1049792700 8:144479321-144479343 TTGGGGCAGGGGCAGGCAGCTGG - Intronic
1050358578 9:4805629-4805651 TGGGCACAGGGACAGTGGGCAGG + Intronic
1050475382 9:6035085-6035107 TTAGCACAGGGGCAGGGCACTGG - Intergenic
1050602466 9:7266820-7266842 TAGGAACAGGGGTAGGGGGCCGG - Intergenic
1050783067 9:9363648-9363670 TTGGCACATAGGCAGTGTGTGGG + Intronic
1051103745 9:13552770-13552792 TTGGCAGAGGGGAAGAGTGATGG - Intergenic
1051110297 9:13627675-13627697 TTAGCACAGGAGCAGGGCACTGG - Intergenic
1051116220 9:13697621-13697643 TGAGCACAAGGGCAGGATGCTGG + Intergenic
1051852677 9:21527882-21527904 GATGCATAGGGGCAGGGTGCTGG + Intergenic
1052173344 9:25427888-25427910 TTGGTGCAGGGGCAGGGAGCTGG - Intergenic
1052173368 9:25428023-25428045 TTAGCATGGGGGCAGAGTGCTGG - Intergenic
1052974394 9:34400674-34400696 TGGGAAGCGGGGCAGGGTGCTGG + Exonic
1053530848 9:38879384-38879406 TTGGCACAGGGGCAGGGTGCTGG - Intergenic
1053542912 9:38993492-38993514 TCGGTGCAGGGGCAGGGTGTTGG + Intergenic
1054203071 9:62103817-62103839 TTGGCACAGGGGCAGGGTGCTGG - Intergenic
1054635292 9:67484548-67484570 TTGGCACAGGGGCAGGGTGCTGG + Intergenic
1054990371 9:71318917-71318939 TGGGGACTGGGGCAGGGGGCTGG - Intronic
1056524184 9:87427418-87427440 TTGGGGCAGGGGCAGGGCGGGGG + Intergenic
1056634526 9:88320599-88320621 TTGGCAGATGGGCTGGGGGCGGG - Intergenic
1056946420 9:91001353-91001375 TTTGCCCTGGGGCAGGGTGAGGG - Intergenic
1057259203 9:93575101-93575123 TGGGCACTGGGGAAGGGGGCGGG - Intergenic
1057979971 9:99650636-99650658 ATAGCTCCGGGGCAGGGTGCTGG - Intergenic
1058315020 9:103554389-103554411 TTGGCATAGGGGTAGGATGCTGG - Intergenic
1058534967 9:105949759-105949781 TCAGGACAGAGGCAGGGTGCTGG + Intergenic
1058986729 9:110214759-110214781 TGGGCAAAGAGGCAGGATGCAGG - Intergenic
1059447270 9:114346156-114346178 TTGGCACGGGGGCAGGGTTCTGG - Intronic
1060403410 9:123361205-123361227 TTGGCACAGGCGCTGGCAGCCGG + Intronic
1060408884 9:123386878-123386900 TGGGAACAGGGAGAGGGTGCAGG + Intronic
1061487713 9:130928738-130928760 GTGGCACAGGGCCAGGGGCCGGG + Intronic
1061569396 9:131467418-131467440 TTGGCACAGGGCCAGGGTTCAGG + Intronic
1061962815 9:133997044-133997066 CTGGCTCAGGGCCTGGGTGCAGG - Intergenic
1062105617 9:134753314-134753336 CAGGCACAGGGGCTGGGTTCCGG + Intronic
1062332064 9:136049218-136049240 GTGGCAAAGGGGCTGGGTTCAGG + Intronic
1062374755 9:136256871-136256893 TGGGGACAGAGGCAGGGAGCAGG + Intergenic
1062455818 9:136637889-136637911 TTGTCACAGGGACTGGGTCCAGG - Intergenic
1185528591 X:799177-799199 TTGCCACAGGGGCTGGGGGATGG - Intergenic
1185617694 X:1433295-1433317 TGGGAACAGGGGGAGGGGGCTGG + Intronic
1187625382 X:21106513-21106535 TTAGGAAAGGGGCAGGGTGAGGG - Intergenic
1187644189 X:21328645-21328667 TTGGCACAGGTGCAGGGCACTGG - Intergenic
1188707605 X:33355293-33355315 CTGGCACAGGGGAAAGATGCAGG - Intergenic
1188768512 X:34125877-34125899 CAGGCTCAGGGGCAGGGTGCTGG + Intergenic
1188771308 X:34157797-34157819 TTGGCACAGGGGTTAGGTGCTGG + Intergenic
1188835402 X:34948397-34948419 GAGGCTCAGGGGCAGGGTGCTGG - Intergenic
1188852717 X:35151134-35151156 TTGGTGCAGGGGCAGGGTGCTGG - Intergenic
1188852735 X:35151265-35151287 TTGGCACAGGGGCAGGGCACAGG - Intergenic
1189558108 X:42166031-42166053 TTGGCGCAGGGGCAATGTGCTGG + Intergenic
1190524056 X:51310799-51310821 TTAGCACAAGGGTGGGGTGCTGG + Intergenic
1191137676 X:57083145-57083167 TTAGCACAGGGGCAGGGCACTGG - Intergenic
1191654879 X:63585852-63585874 TTAGCACAAGGGCAGGGCACTGG + Intergenic
1191695494 X:63985758-63985780 TTGGTGCAAGGGCAGGGTGCTGG - Intergenic
1192166110 X:68828684-68828706 TTGGGACAGGGTCAGTGGGCTGG + Intergenic
1192795897 X:74423528-74423550 TTGGCACAGCAGCGGTGTGCAGG + Intronic
1192926566 X:75760163-75760185 TTAGCACAGGGGCTAGGTGCTGG - Intergenic
1193492462 X:82166175-82166197 GTAGCTCAGGGGCATGGTGCTGG - Intergenic
1193495807 X:82211168-82211190 TTGGGACAGGGACAGGATGCTGG + Intergenic
1193823574 X:86195420-86195442 TTGGAACAGGGACTGGGTGCTGG - Intronic
1193960154 X:87914917-87914939 TTGGCTCAGGGGCAAGGCACTGG - Intergenic
1194323503 X:92481148-92481170 TTGGCACAGGGGCAGGGGCCTGG + Intronic
1194519516 X:94901540-94901562 TTAGCACAGGGGTGGTGTGCCGG + Intergenic
1194891520 X:99384916-99384938 TTGGCACAGAGGGAGGCTGGTGG - Intergenic
1194925661 X:99820212-99820234 TTAGCCCAAGGACAGGGTGCTGG - Intergenic
1194933935 X:99924490-99924512 TTGGGAGAGGGGGAGGGTGAGGG - Intergenic
1195475912 X:105285072-105285094 TTTGCACAGGTGCAAGGAGCAGG - Intronic
1195533264 X:105982129-105982151 TTAGCACAGGGGCAGGGCCCTGG + Intergenic
1195541461 X:106067898-106067920 ATGGGGCAGGGGCAAGGTGCTGG + Intergenic
1195586163 X:106567274-106567296 TTAGCATGGGAGCAGGGTGCTGG - Intergenic
1196350924 X:114727951-114727973 TTGGCACAGGCCCATGGAGCAGG - Intronic
1197404222 X:126029847-126029869 TTGGCACAAGGGTGGGGTGCTGG + Intergenic
1197790467 X:130249031-130249053 GTGGCTCAGGGGCAGGGTGCTGG - Intronic
1198758966 X:140011560-140011582 TCAACACAGGGGCAGGGTGCTGG + Intergenic
1198779776 X:140222021-140222043 TCAACACAGGGGCAGGGTGCTGG - Intergenic
1200226390 X:154420068-154420090 ATGCCACAGGGGCAGGATGATGG - Exonic
1200631605 Y:5594314-5594336 TTGGCACAGGGGCAGGGGCCTGG + Intronic