ID: 1054203073

View in Genome Browser
Species Human (GRCh38)
Location 9:62103824-62103846
Sequence AGCAGTGTTGGCACAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203073_1054203078 -7 Left 1054203073 9:62103824-62103846 CCTGCCCCTGTGCCAACACTGCT No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203073_1054203079 -1 Left 1054203073 9:62103824-62103846 CCTGCCCCTGTGCCAACACTGCT No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203073_1054203081 30 Left 1054203073 9:62103824-62103846 CCTGCCCCTGTGCCAACACTGCT No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203073 Original CRISPR AGCAGTGTTGGCACAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr