ID: 1054203074

View in Genome Browser
Species Human (GRCh38)
Location 9:62103828-62103850
Sequence TGGCAGCAGTGTTGGCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203074_1054203081 26 Left 1054203074 9:62103828-62103850 CCCCTGTGCCAACACTGCTGCCA No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203074_1054203079 -5 Left 1054203074 9:62103828-62103850 CCCCTGTGCCAACACTGCTGCCA No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203074 Original CRISPR TGGCAGCAGTGTTGGCACAG GGG (reversed) Intergenic
No off target data available for this crispr