ID: 1054203076

View in Genome Browser
Species Human (GRCh38)
Location 9:62103830-62103852
Sequence ACTGGCAGCAGTGTTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203076_1054203081 24 Left 1054203076 9:62103830-62103852 CCTGTGCCAACACTGCTGCCAGT No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203076_1054203079 -7 Left 1054203076 9:62103830-62103852 CCTGTGCCAACACTGCTGCCAGT No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203076 Original CRISPR ACTGGCAGCAGTGTTGGCAC AGG (reversed) Intergenic
No off target data available for this crispr