ID: 1054203078

View in Genome Browser
Species Human (GRCh38)
Location 9:62103840-62103862
Sequence CACTGCTGCCAGTGCAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203071_1054203078 0 Left 1054203071 9:62103817-62103839 CCAGCACCCTGCCCCTGTGCCAA 0: 4
1: 5
2: 27
3: 88
4: 451
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203068_1054203078 7 Left 1054203068 9:62103810-62103832 CCCTCCACCAGCACCCTGCCCCT No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203070_1054203078 3 Left 1054203070 9:62103814-62103836 CCACCAGCACCCTGCCCCTGTGC No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203069_1054203078 6 Left 1054203069 9:62103811-62103833 CCTCCACCAGCACCCTGCCCCTG No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203066_1054203078 19 Left 1054203066 9:62103798-62103820 CCTATGAGCCTTCCCTCCACCAG No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203072_1054203078 -6 Left 1054203072 9:62103823-62103845 CCCTGCCCCTGTGCCAACACTGC No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203073_1054203078 -7 Left 1054203073 9:62103824-62103846 CCTGCCCCTGTGCCAACACTGCT No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data
1054203067_1054203078 11 Left 1054203067 9:62103806-62103828 CCTTCCCTCCACCAGCACCCTGC No data
Right 1054203078 9:62103840-62103862 CACTGCTGCCAGTGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203078 Original CRISPR CACTGCTGCCAGTGCAAAAT TGG Intergenic
No off target data available for this crispr