ID: 1054203079

View in Genome Browser
Species Human (GRCh38)
Location 9:62103846-62103868
Sequence TGCCAGTGCAAAATTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203071_1054203079 6 Left 1054203071 9:62103817-62103839 CCAGCACCCTGCCCCTGTGCCAA 0: 4
1: 5
2: 27
3: 88
4: 451
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203066_1054203079 25 Left 1054203066 9:62103798-62103820 CCTATGAGCCTTCCCTCCACCAG No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203073_1054203079 -1 Left 1054203073 9:62103824-62103846 CCTGCCCCTGTGCCAACACTGCT No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203067_1054203079 17 Left 1054203067 9:62103806-62103828 CCTTCCCTCCACCAGCACCCTGC No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203076_1054203079 -7 Left 1054203076 9:62103830-62103852 CCTGTGCCAACACTGCTGCCAGT No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203069_1054203079 12 Left 1054203069 9:62103811-62103833 CCTCCACCAGCACCCTGCCCCTG No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203074_1054203079 -5 Left 1054203074 9:62103828-62103850 CCCCTGTGCCAACACTGCTGCCA No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203072_1054203079 0 Left 1054203072 9:62103823-62103845 CCCTGCCCCTGTGCCAACACTGC No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203070_1054203079 9 Left 1054203070 9:62103814-62103836 CCACCAGCACCCTGCCCCTGTGC No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203075_1054203079 -6 Left 1054203075 9:62103829-62103851 CCCTGTGCCAACACTGCTGCCAG No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data
1054203068_1054203079 13 Left 1054203068 9:62103810-62103832 CCCTCCACCAGCACCCTGCCCCT No data
Right 1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203079 Original CRISPR TGCCAGTGCAAAATTGGACA TGG Intergenic
No off target data available for this crispr