ID: 1054203081

View in Genome Browser
Species Human (GRCh38)
Location 9:62103877-62103899
Sequence AAACTCACCCCTGCCCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054203073_1054203081 30 Left 1054203073 9:62103824-62103846 CCTGCCCCTGTGCCAACACTGCT No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203076_1054203081 24 Left 1054203076 9:62103830-62103852 CCTGTGCCAACACTGCTGCCAGT No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203074_1054203081 26 Left 1054203074 9:62103828-62103850 CCCCTGTGCCAACACTGCTGCCA No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203077_1054203081 18 Left 1054203077 9:62103836-62103858 CCAACACTGCTGCCAGTGCAAAA No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203080_1054203081 6 Left 1054203080 9:62103848-62103870 CCAGTGCAAAATTGGACATGGAG No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data
1054203075_1054203081 25 Left 1054203075 9:62103829-62103851 CCCTGTGCCAACACTGCTGCCAG No data
Right 1054203081 9:62103877-62103899 AAACTCACCCCTGCCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054203081 Original CRISPR AAACTCACCCCTGCCCTGAG TGG Intergenic
No off target data available for this crispr