ID: 1054210076

View in Genome Browser
Species Human (GRCh38)
Location 9:62276615-62276637
Sequence TCTTATGTAAGATTAACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054210076_1054210079 -8 Left 1054210076 9:62276615-62276637 CCATAAGTTAATCTTACATAAGA No data
Right 1054210079 9:62276630-62276652 ACATAAGAGGAAGAAGGCAATGG No data
1054210076_1054210081 11 Left 1054210076 9:62276615-62276637 CCATAAGTTAATCTTACATAAGA No data
Right 1054210081 9:62276649-62276671 ATGGCTAACAAAAGAAAAATGGG No data
1054210076_1054210080 10 Left 1054210076 9:62276615-62276637 CCATAAGTTAATCTTACATAAGA No data
Right 1054210080 9:62276648-62276670 AATGGCTAACAAAAGAAAAATGG No data
1054210076_1054210082 20 Left 1054210076 9:62276615-62276637 CCATAAGTTAATCTTACATAAGA No data
Right 1054210082 9:62276658-62276680 AAAAGAAAAATGGGCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054210076 Original CRISPR TCTTATGTAAGATTAACTTA TGG (reversed) Intergenic
No off target data available for this crispr