ID: 1054210079

View in Genome Browser
Species Human (GRCh38)
Location 9:62276630-62276652
Sequence ACATAAGAGGAAGAAGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054210076_1054210079 -8 Left 1054210076 9:62276615-62276637 CCATAAGTTAATCTTACATAAGA No data
Right 1054210079 9:62276630-62276652 ACATAAGAGGAAGAAGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054210079 Original CRISPR ACATAAGAGGAAGAAGGCAA TGG Intergenic
No off target data available for this crispr