ID: 1054211448

View in Genome Browser
Species Human (GRCh38)
Location 9:62292595-62292617
Sequence GCATGCAGGTGAGCAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054211448_1054211455 16 Left 1054211448 9:62292595-62292617 CCTGTACCTGCTCACCTGCATGC No data
Right 1054211455 9:62292634-62292656 TGGAACACAGCAGGTCAGAGTGG No data
1054211448_1054211452 -4 Left 1054211448 9:62292595-62292617 CCTGTACCTGCTCACCTGCATGC No data
Right 1054211452 9:62292614-62292636 ATGCTCTCTCCTGCAAGAGGTGG No data
1054211448_1054211456 17 Left 1054211448 9:62292595-62292617 CCTGTACCTGCTCACCTGCATGC No data
Right 1054211456 9:62292635-62292657 GGAACACAGCAGGTCAGAGTGGG No data
1054211448_1054211451 -7 Left 1054211448 9:62292595-62292617 CCTGTACCTGCTCACCTGCATGC No data
Right 1054211451 9:62292611-62292633 TGCATGCTCTCTCCTGCAAGAGG No data
1054211448_1054211454 7 Left 1054211448 9:62292595-62292617 CCTGTACCTGCTCACCTGCATGC No data
Right 1054211454 9:62292625-62292647 TGCAAGAGGTGGAACACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054211448 Original CRISPR GCATGCAGGTGAGCAGGTAC AGG (reversed) Intergenic
No off target data available for this crispr