ID: 1054220062

View in Genome Browser
Species Human (GRCh38)
Location 9:62402659-62402681
Sequence TCATTAACAGGACAGTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054220057_1054220062 28 Left 1054220057 9:62402608-62402630 CCTTTACTAATGCATTTATTTTG No data
Right 1054220062 9:62402659-62402681 TCATTAACAGGACAGTGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054220062 Original CRISPR TCATTAACAGGACAGTGTTA AGG Intergenic
No off target data available for this crispr