ID: 1054224949 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:62452694-62452716 |
| Sequence | ATGGCGGCCGGAGCGCTAGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1054224937_1054224949 | 30 | Left | 1054224937 | 9:62452641-62452663 | CCTGAGCGGTAGGAGGGTAGTCT | No data | ||
| Right | 1054224949 | 9:62452694-62452716 | ATGGCGGCCGGAGCGCTAGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1054224949 | Original CRISPR | ATGGCGGCCGGAGCGCTAGG CGG | Intergenic | ||