ID: 1054224949

View in Genome Browser
Species Human (GRCh38)
Location 9:62452694-62452716
Sequence ATGGCGGCCGGAGCGCTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054224937_1054224949 30 Left 1054224937 9:62452641-62452663 CCTGAGCGGTAGGAGGGTAGTCT No data
Right 1054224949 9:62452694-62452716 ATGGCGGCCGGAGCGCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054224949 Original CRISPR ATGGCGGCCGGAGCGCTAGG CGG Intergenic