ID: 1054225240

View in Genome Browser
Species Human (GRCh38)
Location 9:62453940-62453962
Sequence GAGGCTCAGGGTCCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054225230_1054225240 5 Left 1054225230 9:62453912-62453934 CCCCAGGCATGGAGTAGTGGGCA No data
Right 1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG No data
1054225232_1054225240 3 Left 1054225232 9:62453914-62453936 CCAGGCATGGAGTAGTGGGCACC No data
Right 1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG No data
1054225231_1054225240 4 Left 1054225231 9:62453913-62453935 CCCAGGCATGGAGTAGTGGGCAC No data
Right 1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054225240 Original CRISPR GAGGCTCAGGGTCCTGTGGG TGG Intergenic
No off target data available for this crispr