ID: 1054225377

View in Genome Browser
Species Human (GRCh38)
Location 9:62454555-62454577
Sequence TGGGGTGGGTAAGAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054225362_1054225377 19 Left 1054225362 9:62454513-62454535 CCAGGAAGGGGGAGTAGGAGAGC No data
Right 1054225377 9:62454555-62454577 TGGGGTGGGTAAGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054225377 Original CRISPR TGGGGTGGGTAAGAAGCTGC TGG Intergenic
No off target data available for this crispr