ID: 1054230653

View in Genome Browser
Species Human (GRCh38)
Location 9:62506513-62506535
Sequence TCATTAACAGGACAGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054230653_1054230658 28 Left 1054230653 9:62506513-62506535 CCTTAACACTGTCCTGTTAATGA No data
Right 1054230658 9:62506564-62506586 CAAAATAAATGCATTAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054230653 Original CRISPR TCATTAACAGGACAGTGTTA AGG (reversed) Intergenic
No off target data available for this crispr