ID: 1054233568

View in Genome Browser
Species Human (GRCh38)
Location 9:62537693-62537715
Sequence CATTCCAAACATGAATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054233568_1054233570 -4 Left 1054233568 9:62537693-62537715 CCACAAAATTCATGTTTGGAATG No data
Right 1054233570 9:62537712-62537734 AATGCTTATATTCCTGTTGGTGG No data
1054233568_1054233569 -7 Left 1054233568 9:62537693-62537715 CCACAAAATTCATGTTTGGAATG No data
Right 1054233569 9:62537709-62537731 TGGAATGCTTATATTCCTGTTGG No data
1054233568_1054233573 18 Left 1054233568 9:62537693-62537715 CCACAAAATTCATGTTTGGAATG No data
Right 1054233573 9:62537734-62537756 GGAATATAAAACCATACATCTGG No data
1054233568_1054233571 -3 Left 1054233568 9:62537693-62537715 CCACAAAATTCATGTTTGGAATG No data
Right 1054233571 9:62537713-62537735 ATGCTTATATTCCTGTTGGTGGG No data
1054233568_1054233574 23 Left 1054233568 9:62537693-62537715 CCACAAAATTCATGTTTGGAATG No data
Right 1054233574 9:62537739-62537761 ATAAAACCATACATCTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054233568 Original CRISPR CATTCCAAACATGAATTTTG TGG (reversed) Intergenic
No off target data available for this crispr