ID: 1054234327

View in Genome Browser
Species Human (GRCh38)
Location 9:62543557-62543579
Sequence AAGCATGCACACATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054234327_1054234337 26 Left 1054234327 9:62543557-62543579 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054234337 9:62543606-62543628 TGGCCCTCTTTGGACTGTGGAGG No data
1054234327_1054234330 6 Left 1054234327 9:62543557-62543579 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054234330 9:62543586-62543608 GTGCTGACATGCCAGCCCCTTGG No data
1054234327_1054234331 16 Left 1054234327 9:62543557-62543579 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054234331 9:62543596-62543618 GCCAGCCCCTTGGCCCTCTTTGG No data
1054234327_1054234336 23 Left 1054234327 9:62543557-62543579 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054234336 9:62543603-62543625 CCTTGGCCCTCTTTGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054234327 Original CRISPR AAGCATGCACACATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr