ID: 1054236521

View in Genome Browser
Species Human (GRCh38)
Location 9:62564298-62564320
Sequence CTGCAGCAACAGAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054236521_1054236524 0 Left 1054236521 9:62564298-62564320 CCATTTTCCTTCTGTTGCTGCAG No data
Right 1054236524 9:62564321-62564343 TTTGGAAGTAGTTTGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054236521 Original CRISPR CTGCAGCAACAGAAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr