ID: 1054239927

View in Genome Browser
Species Human (GRCh38)
Location 9:62601388-62601410
Sequence TAAGATATACACAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054239927_1054239936 -9 Left 1054239927 9:62601388-62601410 CCCTCCCCCTTGTGTATATCTTA No data
Right 1054239936 9:62601402-62601424 TATATCTTATGGGCAGTGGATGG No data
1054239927_1054239937 23 Left 1054239927 9:62601388-62601410 CCCTCCCCCTTGTGTATATCTTA No data
Right 1054239937 9:62601434-62601456 AAATAACAAATGAAATGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054239927 Original CRISPR TAAGATATACACAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr