ID: 1054242707

View in Genome Browser
Species Human (GRCh38)
Location 9:62630996-62631018
Sequence AGTTATTCACAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054242704_1054242707 4 Left 1054242704 9:62630969-62630991 CCAAGAGTTGTTTCTCAAAAGGA 0: 6
1: 30
2: 252
3: 273
4: 455
Right 1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054242707 Original CRISPR AGTTATTCACAGAAGATGGC AGG Intergenic
No off target data available for this crispr