ID: 1054242910

View in Genome Browser
Species Human (GRCh38)
Location 9:62632685-62632707
Sequence GGGTGCCTTCTCATGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054242906_1054242910 2 Left 1054242906 9:62632660-62632682 CCCTTGGTGCTGTTCTCATGACA 0: 22
1: 146
2: 334
3: 744
4: 978
Right 1054242910 9:62632685-62632707 GGGTGCCTTCTCATGAGATCTGG No data
1054242907_1054242910 1 Left 1054242907 9:62632661-62632683 CCTTGGTGCTGTTCTCATGACAG No data
Right 1054242910 9:62632685-62632707 GGGTGCCTTCTCATGAGATCTGG No data
1054242905_1054242910 7 Left 1054242905 9:62632655-62632677 CCATTCCCTTGGTGCTGTTCTCA No data
Right 1054242910 9:62632685-62632707 GGGTGCCTTCTCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054242910 Original CRISPR GGGTGCCTTCTCATGAGATC TGG Intergenic
No off target data available for this crispr