ID: 1054246227

View in Genome Browser
Species Human (GRCh38)
Location 9:62668998-62669020
Sequence TTGGACTCACAACTAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054246227_1054246233 1 Left 1054246227 9:62668998-62669020 CCTTACTCTAGTTGTGAGTCCAA No data
Right 1054246233 9:62669022-62669044 GGTAGGCATGGAATCGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054246227 Original CRISPR TTGGACTCACAACTAGAGTA AGG (reversed) Intergenic
No off target data available for this crispr