ID: 1054250117

View in Genome Browser
Species Human (GRCh38)
Location 9:62709546-62709568
Sequence AGGGGAAATAAGAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054250110_1054250117 18 Left 1054250110 9:62709505-62709527 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1054250117 9:62709546-62709568 AGGGGAAATAAGAGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054250117 Original CRISPR AGGGGAAATAAGAGGGATGC TGG Intergenic
No off target data available for this crispr