ID: 1054254169

View in Genome Browser
Species Human (GRCh38)
Location 9:62748066-62748088
Sequence CTATTGGTATGGAGGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054254169_1054254174 -4 Left 1054254169 9:62748066-62748088 CCTTCTGTCCTCCATACCAATAG No data
Right 1054254174 9:62748085-62748107 ATAGGCAGTTACAGCTGATTTGG No data
1054254169_1054254175 4 Left 1054254169 9:62748066-62748088 CCTTCTGTCCTCCATACCAATAG No data
Right 1054254175 9:62748093-62748115 TTACAGCTGATTTGGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054254169 Original CRISPR CTATTGGTATGGAGGACAGA AGG (reversed) Intergenic
No off target data available for this crispr