ID: 1054256721

View in Genome Browser
Species Human (GRCh38)
Location 9:62822104-62822126
Sequence ATGTATTTAATGAAGTGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054256721_1054256722 2 Left 1054256721 9:62822104-62822126 CCGGATCACTTCATTAAATACAT No data
Right 1054256722 9:62822129-62822151 TTTTTTCAAAATGTTAAAGCAGG No data
1054256721_1054256723 3 Left 1054256721 9:62822104-62822126 CCGGATCACTTCATTAAATACAT No data
Right 1054256723 9:62822130-62822152 TTTTTCAAAATGTTAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054256721 Original CRISPR ATGTATTTAATGAAGTGATC CGG (reversed) Intergenic
No off target data available for this crispr