ID: 1054259288

View in Genome Browser
Species Human (GRCh38)
Location 9:62845475-62845497
Sequence CTCTGGACAAGTGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054259288_1054259294 4 Left 1054259288 9:62845475-62845497 CCCTTCCCAGCACTTGTCCAGAG No data
Right 1054259294 9:62845502-62845524 TTTCTCCCTCAGCACAGCTCAGG No data
1054259288_1054259297 11 Left 1054259288 9:62845475-62845497 CCCTTCCCAGCACTTGTCCAGAG No data
Right 1054259297 9:62845509-62845531 CTCAGCACAGCTCAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054259288 Original CRISPR CTCTGGACAAGTGCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr