ID: 1054264209

View in Genome Browser
Species Human (GRCh38)
Location 9:62902745-62902767
Sequence CATTCCAAACATGAATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054264209_1054264211 -4 Left 1054264209 9:62902745-62902767 CCACAAAATTCATGTTTGGAATG No data
Right 1054264211 9:62902764-62902786 AATGCTTATATTCCTGTTGGTGG No data
1054264209_1054264210 -7 Left 1054264209 9:62902745-62902767 CCACAAAATTCATGTTTGGAATG No data
Right 1054264210 9:62902761-62902783 TGGAATGCTTATATTCCTGTTGG No data
1054264209_1054264212 -3 Left 1054264209 9:62902745-62902767 CCACAAAATTCATGTTTGGAATG No data
Right 1054264212 9:62902765-62902787 ATGCTTATATTCCTGTTGGTGGG No data
1054264209_1054264214 23 Left 1054264209 9:62902745-62902767 CCACAAAATTCATGTTTGGAATG No data
Right 1054264214 9:62902791-62902813 ATAAAACCGTACATCTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054264209 Original CRISPR CATTCCAAACATGAATTTTG TGG (reversed) Intergenic
No off target data available for this crispr