ID: 1054264947

View in Genome Browser
Species Human (GRCh38)
Location 9:62908613-62908635
Sequence AAGCATGCACACATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054264947_1054264950 6 Left 1054264947 9:62908613-62908635 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054264950 9:62908642-62908664 GTGCTGACATGCCAGCCCCTTGG No data
1054264947_1054264956 23 Left 1054264947 9:62908613-62908635 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054264956 9:62908659-62908681 CCTTGGCCCCCTTTGGACTGTGG No data
1054264947_1054264957 26 Left 1054264947 9:62908613-62908635 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054264957 9:62908662-62908684 TGGCCCCCTTTGGACTGTGGAGG No data
1054264947_1054264951 16 Left 1054264947 9:62908613-62908635 CCCAGCTGCATGTGTGCATGCTT No data
Right 1054264951 9:62908652-62908674 GCCAGCCCCTTGGCCCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054264947 Original CRISPR AAGCATGCACACATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr