ID: 1054267172

View in Genome Browser
Species Human (GRCh38)
Location 9:62929356-62929378
Sequence CTGCAGCAACAGAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054267172_1054267175 0 Left 1054267172 9:62929356-62929378 CCATTTTCCTTCTGTTGCTGCAG No data
Right 1054267175 9:62929379-62929401 TTTGGAAGTAGTTTGTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054267172 Original CRISPR CTGCAGCAACAGAAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr