ID: 1054269236

View in Genome Browser
Species Human (GRCh38)
Location 9:62952544-62952566
Sequence TGTGTGTGTTATCATTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054269236_1054269238 15 Left 1054269236 9:62952544-62952566 CCAGTGTAATGATAACACACACA No data
Right 1054269238 9:62952582-62952604 TTGGAACATCAGTTTGTCACTGG No data
1054269236_1054269239 24 Left 1054269236 9:62952544-62952566 CCAGTGTAATGATAACACACACA No data
Right 1054269239 9:62952591-62952613 CAGTTTGTCACTGGTTGTTCAGG No data
1054269236_1054269237 -4 Left 1054269236 9:62952544-62952566 CCAGTGTAATGATAACACACACA No data
Right 1054269237 9:62952563-62952585 CACACTGTATAAACAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054269236 Original CRISPR TGTGTGTGTTATCATTACAC TGG (reversed) Intergenic
No off target data available for this crispr