ID: 1054269237

View in Genome Browser
Species Human (GRCh38)
Location 9:62952563-62952585
Sequence CACACTGTATAAACAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054269236_1054269237 -4 Left 1054269236 9:62952544-62952566 CCAGTGTAATGATAACACACACA No data
Right 1054269237 9:62952563-62952585 CACACTGTATAAACAGATATTGG No data
1054269235_1054269237 4 Left 1054269235 9:62952536-62952558 CCATTTTGCCAGTGTAATGATAA No data
Right 1054269237 9:62952563-62952585 CACACTGTATAAACAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054269237 Original CRISPR CACACTGTATAAACAGATAT TGG Intergenic
No off target data available for this crispr