ID: 1054269285

View in Genome Browser
Species Human (GRCh38)
Location 9:62952976-62952998
Sequence CAGGATCAGCATAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054269285_1054269292 18 Left 1054269285 9:62952976-62952998 CCCACCTCTTTATGCTGATCCTG No data
Right 1054269292 9:62953017-62953039 AGGCTCAACAGTTAAGTCTCAGG No data
1054269285_1054269293 19 Left 1054269285 9:62952976-62952998 CCCACCTCTTTATGCTGATCCTG No data
Right 1054269293 9:62953018-62953040 GGCTCAACAGTTAAGTCTCAGGG No data
1054269285_1054269289 -2 Left 1054269285 9:62952976-62952998 CCCACCTCTTTATGCTGATCCTG No data
Right 1054269289 9:62952997-62953019 TGTCCTTGTCCTGTCTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054269285 Original CRISPR CAGGATCAGCATAAAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr