ID: 1054272653

View in Genome Browser
Species Human (GRCh38)
Location 9:63045465-63045487
Sequence GACACCTCCAAGTCCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054272650_1054272653 7 Left 1054272650 9:63045435-63045457 CCAACGTTGGGGCAGGGCAAATC No data
Right 1054272653 9:63045465-63045487 GACACCTCCAAGTCCAGCTCTGG No data
1054272644_1054272653 23 Left 1054272644 9:63045419-63045441 CCAGAGCAGGGCTGGGCCAACGT No data
Right 1054272653 9:63045465-63045487 GACACCTCCAAGTCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054272653 Original CRISPR GACACCTCCAAGTCCAGCTC TGG Intergenic
No off target data available for this crispr